![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-130b |
||||||
Accession | MI0000408 (change log) | |||||
Symbol | MGI:Mir130b | |||||
Description | Mus musculus miR-130b stem-loop | |||||
Gene family | MIPF0000034; mir-130 | |||||
Literature search |
![]()
82 open access papers mention mmu-mir-130b | |||||
Stem-loop |
u ca cc a guggg u 5' ggcuug ugga cucuuuc uguugcacu cu cc c |||||| |||| ||||||| ||||||||| || || 3' ccgggc gucu gggaaag guaacguga ga gg u u ac ua c ----a g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-130b-5p |
|
Accession | MIMAT0004583 |
Previous IDs | mmu-miR-130b* |
Sequence |
13 - acucuuucccuguugcacuacu - 34 |
Deep sequencing | 8527 reads, 95 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-130b-3p |
|
Accession | MIMAT0000387 |
Previous IDs | mmu-miR-130b |
Sequence |
51 - cagugcaaugaugaaagggcau - 72 |
Deep sequencing | 90954 reads, 106 experiments |
Evidence | experimental; cloned [1-3], Northern [1], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|