![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-303 |
||||||||||||
Accession | MI0000409 (change log) | |||||||||||
Description | Drosophila melanogaster miR-303 stem-loop | |||||||||||
Gene family | MIPF0001013; mir-303 | |||||||||||
Literature search |
2 open access papers mention dme-mir-303 | |||||||||||
Stem-loop |
ua c c aau 5' ucuugguu gguuu a aggaaacugguuu a |||||||| ||||| | ||||||||||||| 3' agaacuaa cuaaa u uccuuugaucaaa a uc a c agc |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence dme-miR-303-5p |
|
Accession | MIMAT0000388 |
Previous IDs | dme-miR-303 |
Sequence |
7 - uuuagguuucacaggaaacuggu - 29 |
Deep sequencing | 991 reads, 30 experiments |
Evidence | experimental; cloned [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence dme-miR-303-3p |
|
Accession | MIMAT0020824 |
Sequence |
43 - cuaguuuccucuaaaauccuaa - 64 |
Deep sequencing | 172 reads, 14 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|