Stem-loop sequence dme-mir-303

AccessionMI0000409 (change log)
DescriptionDrosophila melanogaster miR-303 stem-loop
Gene family MIPF0001013; mir-303
Literature search

2 open access papers mention dme-mir-303
(9 sentences)

Stem-loop
           ua     c c             aau 
5' ucuugguu  gguuu a aggaaacugguuu   a
   ||||||||  ||||| | |||||||||||||    
3' agaacuaa  cuaaa u uccuuugaucaaa   a
           uc     a c             agc 
Get sequence
Deep sequencing
1164 reads, 141 reads per million, 32 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chrX: 4366179-4366248 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-303
dme-mir-984chrX: 4368646-4368735 [-]
dme-mir-983-2chrX: 4368483-4368581 [-]
dme-mir-983-1chrX: 4368309-4368399 [-]
dme-mir-303chrX: 4366179-4366248 [-]
dme-mir-982chrX: 4365806-4365898 [-]
Database links

Mature sequence dme-miR-303-5p

Accession MIMAT0000388
Previous IDsdme-miR-303
Sequence

7 - 

uuuagguuucacaggaaacuggu

 - 29

Get sequence
Deep sequencing991 reads, 30 experiments
Evidence experimental; cloned [1], 454 [2-3], Illumina [3]
Database links
Predicted targets

Mature sequence dme-miR-303-3p

Accession MIMAT0020824
Sequence

43 - 

cuaguuuccucuaaaauccuaa

 - 64

Get sequence
Deep sequencing172 reads, 14 experiments
Evidence not experimental
Database links

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).