Stem-loop sequence dme-mir-306

Accession MI0000414
Description Drosophila melanogaster miR-306 stem-loop
Gene family MIPF0000313; mir-306
Stem-loop 
-g      c au   u       uu           --   - u 
  uccacu g  ggc cagguac  agugacucuca  aug c u
  |||||| |  ||| |||||||  |||||||||||  ||| |  
  ggguga c  ucg guccgug  ucacugggggu  uac g u
ca      - cg   u       uc           uu   a u
Get sequence
Deep sequencing
574873 reads, 50 experiments
Comments

miR-306 was identified and ends mapped by cloning. Reference [1] also identified a less predominantly expressed miR from the opposite arm of the precursor, designated miR-306* here. The sequence is localised to chromosome X.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2L: 16698404-16698488 [+]
sense
FBtr0100459 ; grp-RD; intron 4
FBtr0100459 ; grp-RD; intron 4
FBtr0100459 ; grp-RD; intron 4
FBtr0080886 ; grp-RA; intron 6
FBtr0080884 ; grp-RB; intron 6
FBtr0080886 ; grp-RA; intron 6
FBtr0080884 ; grp-RB; intron 6
FBtr0080886 ; grp-RA; intron 6
FBtr0080884 ; grp-RB; intron 6
FBtr0080885 ; grp-RC; intron 7
FBtr0080885 ; grp-RC; intron 7
FBtr0080885 ; grp-RC; intron 7
Clustered miRNAs
< 10kb from dme-mir-306
dme-mir-9c 2L: 16697924-16698015 [+]
dme-mir-306 2L: 16698404-16698488 [+]
dme-mir-79 2L: 16698554-16698650 [+]
dme-mir-9b 2L: 16698744-16698834 [+]

Mature sequence dme-miR-306-5p

Accession MIMAT0000393
Previous IDs dme-miR-306
Sequence

15 -  

ucagguacuuagugacucucaa

 - 36

Get sequence
Deep sequencing 559104 reads, 50 experiments
Evidence experimental; cloned [1], 454 [2-3], Solexa [3]
Predicted targets

Mature sequence dme-miR-306-3p

Accession MIMAT0000394
Previous IDs dme-miR-306*
Sequence

52 -  

gggggucacucugugccugugc

 - 73

Get sequence
Deep sequencing 15767 reads, 49 experiments
Evidence experimental; cloned [1], 454 [2-3], Solexa [3]
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).