Stem-loop sequence dme-mir-307a

Accession MI0000418
Previous IDs dme-mir-307
Description Drosophila melanogaster miR-307a stem-loop
Gene family MIPF0000293; mir-67
Stem-loop 
u        -   a         ccu  g       -u    uc 
 gucuugcu uug cucacucaa   gg ugugaug  uauu  g
 |||||||| ||| |||||||||   || |||||||  ||||  a
 caggacga agc gagugaguu   cc acacuac  augg  u
a        u   -         ccu  a       cu    ua
Get sequence
Deep sequencing
54444 reads, 50 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 5508756-5508843 [-]
sense
FBtr0088501 ; Mmp2-RB; intron 3
FBtr0088501 ; Mmp2-RB; intron 3
FBtr0088501 ; Mmp2-RB; intron 3
antisense
FBtr0304171 ; mir-307b-RM; exon 1
FBtr0304171 ; mir-307b-RM; exon 1
Clustered miRNAs
< 10kb from dme-mir-307a
dme-mir-307a 2R: 5508756-5508843 [-]
dme-mir-307b 2R: 5508739-5508858 [+]

Mature sequence dme-miR-307a-5p

Accession MIMAT0020832
Sequence

13 -  

acucacucaaccugggugugau

 - 34

Get sequence
Deep sequencing 9186 reads, 47 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-307a-3p

Accession MIMAT0000398
Previous IDs dme-miR-307
Sequence

56 -  

ucacaaccuccuugagugag

 - 75

Get sequence
Deep sequencing 45192 reads, 50 experiments
Evidence experimental; cloned [1], 454 [2-3], Solexa [3]
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).