![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-308 |
|||||
Accession | MI0000419 (change log) | ||||
Description | Drosophila melanogaster miR-308 stem-loop | ||||
Gene family | MIPF0000171; mir-308 | ||||
Literature search |
3 open access papers mention dme-mir-308 | ||||
Stem-loop |
u u uu c u 5' cucgcaguaua uuuugug uuug u g u ||||||||||| ||||||| |||| | | u 3' gagugucauau aggacac aaac a c u u u cu a g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-308-5p |
|
Accession | MIMAT0020833 |
Sequence |
3 - cgcaguauauuuuuguguuuug - 24 |
Deep sequencing | 13849 reads, 49 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-308-3p |
|
Accession | MIMAT0000399 |
Previous IDs | dme-miR-308 |
Sequence |
42 - aaucacaggauuauacugugag - 63 |
Deep sequencing | 528690 reads, 48 experiments |
Evidence | experimental; cloned [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|