Stem-loop sequence dme-mir-308

Accession MI0000419
Description Drosophila melanogaster miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop 
           u       u    uu c u 
cucgcaguaua uuuugug uuug  u g u
||||||||||| ||||||| ||||  | | u
gagugucauau aggacac aaac  a c u
           u       u    cu a g
Get sequence
Deep sequencing
942015 reads, 50 experiments
Comments

miR-308 was identified and 5' end mapped by cloning. Reference [1] reports a length distribution of 18-22 nt, with 22 nt most commonly expressed. The sequence is localised to chromosome 2R.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 10103307-10103369 [-]
sense
FBtr0087575 ; RpS23-RA; intron 2
FBtr0087575 ; RpS23-RA; intron 2
FBtr0087575 ; RpS23-RA; intron 2

Mature sequence dme-miR-308-5p

Accession MIMAT0020833
Sequence

3 -  

cgcaguauauuuuuguguuuug

 - 24

Get sequence
Deep sequencing 26436 reads, 50 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-308-3p

Accession MIMAT0000399
Previous IDs dme-miR-308
Sequence

42 -  

aaucacaggauuauacugugag

 - 63

Get sequence
Deep sequencing 915527 reads, 50 experiments
Evidence experimental; cloned [1], 454 [2-3], Solexa [3]
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
3
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).