|
miRBase |
|
Stem-loop sequence dme-mir-312 |
|||||
| Accession | MI0000424 | ||||
| Description | Drosophila melanogaster miR-312 stem-loop | ||||
| Gene family | MIPF0000573; mir-312 | ||||
| Stem-loop |
u u a g u cauu gauu ggu cguc caag gcaau cug u |||| ||| |||| |||| ||||| ||| u uuag ccg gcag guuc cguua gau u u - a a u caau |
||||
| Deep sequencing |
| ||||
| Comments |
miR-312 was identified and 5' end mapped by cloning. Reference [1] reports a length distribution of 22-23 nt, with 22 nt most commonly expressed. The sequence is localised to chromosome 2R. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
Mature sequence dme-miR-312-5p |
|
| Accession | MIMAT0020838 |
| Sequence |
5 - ugguucgucacaagggcaauucu - 27 |
| Deep sequencing | 5435 reads, 40 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence dme-miR-312-3p |
|
| Accession | MIMAT0000404 |
| Previous IDs | dme-miR-312 |
| Sequence |
43 - uauugcacuugagacggccuga - 64 |
| Deep sequencing | 39596 reads, 44 experiments |
| Evidence | experimental; cloned [1], Northern [1], 454 [2-3], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
| 2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|