Stem-loop sequence dme-mir-316

Accession MI0000428
Description Drosophila melanogaster miR-316 stem-loop
Gene family MIPF0000254; mir-316
Stem-loop 
      -    c   u           g   -a   g    ucaa 
aaauuc uagu gau ugucuuuuucc cuu  cug cguu    u
|||||| |||| ||| ||||||||||| |||  ||| ||||     
uuugag auca uua gcggaaaaagg gaa  gac gcaa    u
      u    u   u           -   ag   a    cacc
Get sequence
Deep sequencing
13090 reads, 40 experiments
Comments

Lai et al. predicted this sequence based on conservation in D. pseudoobscura, but did not verify expression [2]. Aravin et al. describe identification and mapping of the 5' end of the excised sequence by cloning [1]. They report a length distribution of 20-22 nt, with 22 nt most commonly expressed. The sequence maps to chromosome 3L.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3L: 21661814-21661902 [-]
intergenic

Mature sequence dme-miR-316-5p

Accession MIMAT0000408
Previous IDs dme-miR-316
Sequence

16 -  

ugucuuuuuccgcuuacuggcg

 - 37

Get sequence
Deep sequencing 11875 reads, 40 experiments
Evidence experimental; cloned [1], 454 [3-4], Solexa [4]
Predicted targets

Mature sequence dme-miR-316-3p

Accession MIMAT0020842
Sequence

54 -  

acaggaaagggaaaaaggcgua

 - 75

Get sequence
Deep sequencing 1215 reads, 36 experiments
Evidence not experimental
Predicted targets

References

1
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
2
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).
3
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
4
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).