|
miRBase |
|
Stem-loop sequence dme-mir-317 |
||||||||
| Accession | MI0000429 | |||||||
| Description | Drosophila melanogaster miR-317 stem-loop | |||||||
| Gene family | MIPF0000144; mir-317 | |||||||
| Stem-loop |
--a u aua -- c u aa a augc ac gccauuggg cacc cugug ucgcuu g ug a |||| || ||||||||| |||| ||||| |||||| | || a uacg ug cggugaccu gugg gacac agugaa c ac u guu c aug uc a - ga g |
|||||||
| Deep sequencing |
| |||||||
| Comments |
miR-317 was identified and 5' end mapped by cloning. Reference [1] reports a length distribution of 20-24 nt, with 24 nt most commonly expressed. The sequence is localised to chromosome 3R. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
Mature sequence dme-miR-317-5p |
|
| Accession | MIMAT0020843 |
| Sequence |
14 - ugggauacacccugugcucgcu - 35 |
| Deep sequencing | 26998 reads, 49 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence dme-miR-317-3p |
|
| Accession | MIMAT0000409 |
| Previous IDs | dme-miR-317 |
| Sequence |
56 - ugaacacagcuggugguauccagu - 79 |
| Deep sequencing | 399179 reads, 50 experiments |
| Evidence | experimental; cloned [1], 454 [2-3], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
| 2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
| 3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|