![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-318 |
||||||
Accession | MI0000430 (change log) | |||||
Description | Drosophila melanogaster miR-318 stem-loop | |||||
Gene family | MIPF0000259; mir-318 | |||||
Literature search |
2 open access papers mention dme-mir-318 | |||||
Stem-loop |
u c c uu caca 5' uuaugggaua aca aguucagu ugu c |||||||||| ||| |||||||| ||| 3' aguacucuau ugu ucggguca acg u g u u cu aacu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence dme-miR-318-5p |
|
Accession | MIMAT0020844 |
Sequence |
7 - ggauacacacaguucaguuuug - 28 |
Deep sequencing | 1291 reads, 24 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-318-3p |
|
Accession | MIMAT0000410 |
Previous IDs | dme-miR-318 |
Sequence |
43 - ucacugggcuuuguuuaucuca - 64 |
Deep sequencing | 828611 reads, 49 experiments |
Evidence | experimental; cloned [1], 454 [2-3], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
2 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
3 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|