Stem-loop sequence hsa-mir-125b-1

Accession

MI0000446 (change log)

Symbol

HGNC:MIR125B1

Description

Homo sapiens miR-125b-1 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

685 open access papers mention hsa-mir-125b-1
(4114 sentences)

Stem-loop

   u    uc   u   uc  ug   c           au     c 
5'  gcgc  cuc cag  cc  aga ccuaacuugug  guuua c
    ||||  ||| |||  ||  ||| |||||||||||  ||||| g
3'  cgug  gag guc  gg  ucu ggauugggcac  uaaau u
   u    cu   c   ga  gu   c           -c     u 

Deep sequencing

4588477 reads, 1.38e+04 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 122099757-122099844 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000387568 ; RP11-820L6.1-006; intron 2

  OTTHUMT00000387569 ; RP11-820L6.1-008; intron 2

  OTTHUMT00000387551 ; RP11-820L6.1-001; intron 3

  ENST00000529804 ; RP11-820L6.1-006; intron 2

  ENST00000529733 ; RP11-820L6.1-008; intron 2

  ENST00000527474 ; RP11-820L6.1-001; intron 3

Database links

• EntrezGene:MIR125B1
• HGNC:MIR125B1
• RNAcentral:URS00002A66E1_9606
• miRBase Tracker:MI0000446

Mature sequence hsa-miR-125b-5p

• Accession: MIMAT0000423
• Previous IDs: hsa-miR-125b
• Sequence: 15 - ucccugagacccuaacuuguga - 36
• Deep sequencing: 8234367 reads, 159 experiments
• Evidence: experimental; cloned [2,4-6], Illumina [7]
• Database links:
  • RNAcentral:URS0000209905_9606
• Predicted targets:
  • TargetMiner:hsa-miR-125b-5p
  • TargetScanVert:hsa-miR-125b-5p
  • miRDB:hsa-miR-125b-5p
  • microrna.org:hsa-miR-125b-5p

Mature sequence hsa-miR-125b-1-3p

• Accession: MIMAT0004592
• Previous IDs: hsa-miR-125b-1*
• Sequence: 55 - acggguuaggcucuugggagcu - 76
• Deep sequencing: 9343 reads, 133 experiments
• Evidence: experimental; cloned [5]
• Database links:
  • RNAcentral:URS00002DABEA_9606
• Predicted targets:
  • TargetMiner:hsa-miR-125b-1-3p
  • TargetScanVert:hsa-miR-125b-1-3p
  • miRDB:hsa-miR-125b-1-3p
  • microrna.org:hsa-miR-125b-1-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3. PMID:15722555 "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation" Lee YS, Kim HK, Chung S, Kim KS, Dutta A J Biol Chem. 280:16635-16641(2005).
4. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).