Stem-loop hsa-mir-130a

Accession

MI0000448

Symbol

HGNC: MIR130A

Description

Homo sapiens hsa-mir-130a precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR130A is a microRNA that has been identified as one of the miRNAs enriched in extracellular vesicles (EVs) from melanoma cells, which is associated with the metastatic process of this skin cancer [PMC9871288]. Studies have demonstrated that MIR130A plays a significant role in various biological processes, and its inhibition has been linked to positive outcomes in the context of cerebral ischemia [PMC6732937]. Specifically, targeting MIR130A has been shown to decrease blood-brain barrier (BBB) permeability and brain edema while improving neurological functions by influencing the expression of Homeobox1 [PMC6732937]. This suggests that MIR130A could be a potential therapeutic target not only for melanoma metastasis but also for conditions involving cerebral ischemia and BBB integrity [PMC9871288; PMC6732937]..

Literature search

188 open access papers mention hsa-mir-130a
(1154 sentences)

Sequence

162102 reads, 2307 reads per million, 131 experiments

ugcugcuggccagaGCUCUUUUCACAUUGUGCUACUgucugcaccugucacuagCAGUGCAAUGUUAAAAGGGCAUuggccguguagug
.((((((((((((.((((((((.((((((((((.(((...((....))...))).)))))))))).)))))))).))))))).))))).

Structure

u     -       a        C          A   ucu  a 
 gcugc uggccag GCUCUUUU ACAUUGUGCU CUg   gc c
 ||||| ||||||| |||||||| |||||||||| |||   ||  
 ugaug gccgguU CGGGAAAA UGUAACGUGA gau   ug c
g     u       A        U          C   cac  u 

Annotation confidence High

Comments

miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context

chr11: 57641198-57641286 [+]

Disease association

hsa-mir-130a is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-130a-5p

• Accession: MIMAT0004593
• Description: Homo sapiens hsa-miR-130a-5p mature miRNA
• Sequence: 15 - GCUCUUUUCACAUUGUGCUACU - 36
• Evidence: experimental ; cloned [3]

Mature hsa-miR-130a-3p

• Accession: MIMAT0000425
• Description: Homo sapiens hsa-miR-130a-3p mature miRNA
• Sequence: 55 - CAGUGCAAUGUUAAAAGGGCAU - 76
• Evidence: experimental ; cloned [2-4], Northern [2]

References

1. PubMed ID: 15183728
   Human embryonic stem cells express a unique set of microRNAs
   "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
   "Dev Biol (2004) 270:488-498


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739