Stem-loop sequence hsa-mir-143

Accession MI0000459
Symbol HGNC:MIR143
Description Homo sapiens miR-143 stem-loop
Gene family MIPF0000094; mir-143
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-gc    c  ccug    c ag      g         g      u  -  ag 
   gcag gc    ucuc c  ccugag ugcagugcu caucuc gg uc  u
   |||| ||    |||| |  |||||| ||||||||| |||||| || ||   
   cguc ug    agag g  ggacuc augucacga guagag cu ag  u
cga    u  uuga    a aa      g         a      u  g  gg 
Get sequence
Deep sequencing
12540 reads, 59 experiments
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-143 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. miR-143 cloned in [3] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 148808481-148808586 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-143
hsa-mir-143 chr5: 148808481-148808586 [+]
hsa-mir-145 chr5: 148810209-148810296 [+]
Database links

Mature sequence hsa-miR-143-5p

Accession MIMAT0004599
Previous IDs hsa-miR-143*
Sequence

27 - 

ggugcagugcugcaucucuggu

 - 48

Get sequence
Deep sequencing 606 reads, 8 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-143-3p

Accession MIMAT0000435
Previous IDs hsa-miR-143
Sequence

61 - 

ugagaugaagcacuguagcuc

 - 81

Get sequence
Deep sequencing 11857 reads, 50 experiments
Evidence experimental; cloned [2-3], Solexa [4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4