Stem-loop sequence hsa-mir-129-2

Accession

MI0000473 (change log)

Previous IDs

hsa-mir-129b

Symbol

HGNC:MIR129-2

Description

Homo sapiens miR-129-2 stem-loop

Gene family

MIPF0000073; mir-129

Literature search

136 open access papers mention hsa-mir-129-2
(1222 sentences)

Stem-loop

   u             -       c   cu      ---     acau 
5'  gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
    ||||||||||||| ||||||| |||  ||||||   |||||     
3'  cgggaggcguuua gaaaaac cca  cccgaa   cgaua    a
   g             c       c   uu      ggc     acuc 

Deep sequencing

82435 reads, 68.6 reads per million, 156 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MI0000252) and mouse (MI0000222 and MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (MI0000222) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 43581394-43581483 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000337474 ; AC023085.1-001; intron 1

  OTTHUMT00000389683 ; HSD17B12-008; intron 2

  ENST00000446181 ; MIR670HG-001; intron 1

  ENST00000526615 ; HSD17B12-008; intron 2

Database links

• EntrezGene:MIR129-2
• HGNC:MIR129-2
• RNAcentral:URS00006515A6_9606
• miRBase Tracker:MI0000473

Mature sequence hsa-miR-129-5p

• Accession: MIMAT0000242
• Previous IDs: hsa-miR-129
• Sequence: 15 - cuuuuugcggucugggcuugc - 35
• Deep sequencing: 127090 reads, 146 experiments
• Evidence: experimental; cloned [2-3]
• Database links:
  • RNAcentral:URS00004E1410_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-129-5p
  • miRDB:hsa-miR-129-5p
  • microrna.org:hsa-miR-129-5p

Mature sequence hsa-miR-129-2-3p

• Accession: MIMAT0004605
• Previous IDs: hsa-miR-129-3p
• Sequence: 57 - aagcccuuaccccaaaaagcau - 78
• Deep sequencing: 18883 reads, 136 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS000048F59D_9606
• Predicted targets:
  • TargetMiner:hsa-miR-129-2-3p
  • TargetScanVert:hsa-miR-129-2-3p
  • miRDB:hsa-miR-129-2-3p
  • microrna.org:hsa-miR-129-2-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).