![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-129-2 |
|||||
Accession | MI0000473 (change log) | ||||
Previous IDs | hsa-mir-129b | ||||
Symbol | HGNC:MIR129-2 | ||||
Description | Homo sapiens miR-129-2 stem-loop | ||||
Gene family | MIPF0000073; mir-129 | ||||
Literature search |
![]()
136 open access papers mention hsa-mir-129-2 | ||||
Stem-loop |
u - c cu --- acau 5' gcccuucgcgaau cuuuuug ggu gggcuu gcugu a ||||||||||||| ||||||| ||| |||||| ||||| 3' cgggaggcguuua gaaaaac cca cccgaa cgaua a g c c uu ggc acuc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MI0000252) and mouse (MI0000222 and MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (MI0000222) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-129-5p |
|
Accession | MIMAT0000242 |
Previous IDs | hsa-miR-129 |
Sequence |
15 - cuuuuugcggucugggcuugc - 35 |
Deep sequencing | 127090 reads, 146 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-129-2-3p |
|
Accession | MIMAT0004605 |
Previous IDs | hsa-miR-129-3p |
Sequence |
57 - aagcccuuaccccaaaaagcau - 78 |
Deep sequencing | 18883 reads, 136 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|