Stem-loop sequence hsa-mir-194-1

AccessionMI0000488 (change log)
Previous IDshsa-mir-194
Symbol HGNC:MIR194-1
DescriptionHomo sapiens miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Literature search

143 open access papers mention hsa-mir-194-1
(1005 sentences)

Stem-loop
   a    - uu      u         a      g    cu  gu 
5'  uggu g  aucaag guaacagca cuccau ugga  gu  a
    |||| |  |||||| ||||||||| |||||| ||||  ||   
3'  acca u  uaguuu cauugucgu gaggug accu  ua  c
   a    u gg      u         a      -    -u  ac 
Get sequence
Deep sequencing
109326 reads, 168 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236) on chromosome 1, and mir-194-2 (MI0000733) on chromosome 19) and human (mir-194-1 (MI0000488) on chromosome 1, and mir-194-2 (MI0000732) on chromosome 11).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 220118157-220118241 [-]
sense
OTTHUMT00000098802 ; SLC30A10-002; intron 1
ENST00000484239 ; SLC30A10-002; intron 1
ENST00000536446 ; SLC30A10-201; intron 1
Clustered miRNAs
< 10kb from hsa-mir-194-1
hsa-mir-194-1chr1: 220118157-220118241 [-]
hsa-mir-215chr1: 220117853-220117962 [-]
Database links

Mature sequence hsa-miR-194-5p

Accession MIMAT0000460
Previous IDshsa-miR-194
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing215327 reads, 154 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).