Stem-loop sequence cbr-let-7

AccessionMI0000491 (change log)
DescriptionCaenorhabditis briggsae let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention cbr-let-7
(12 sentences)

Stem-loop
   a    gg a           u  g           ----   au 
5'  cugg  u cggugagguag ag uuguauaguuu    aga  a
    ||||  | ||||||||||| || |||||||||||    |||  u
3'  gacc  a gccacuccauc uu aacguaucaag    ucu  u
   g    au a           u  g           uggc   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 18534121-18534207 [+]
intergenic
Database links

Mature sequence cbr-let-7

Accession MIMAT0000463
Sequence

13 - 

ugagguaguagguuguauaguu

 - 34

Get sequence
Evidence by similarity; MI0000001

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).