|
miRBase |
|
Stem-loop sequence cbr-mir-60 |
|||||
| Accession | MI0000509 | ||||
| Description | Caenorhabditis briggsae miR-60 stem-loop | ||||
| Gene family | MIPF0000298; mir-60 | ||||
| Stem-loop |
u ag - a a a cc ucuug cuggaaag gug cauaa auc ugu a ||||| |||||||| ||| ||||| ||| ||| agaac gaucuuuu cac guauu uag gca a c cu a - a c cg |
||||
| Deep sequencing |
| ||||
| Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae. |
||||
| Genome context |
|
||||
Mature sequence cbr-miR-60 |
|
| Accession | MIMAT0000479 |
| Sequence |
46 - uauuaugcacauuuucuagucca - 68 |
| Deep sequencing | 1232 reads, 1 experiments |
| Evidence | by similarity; MI0000031 |
References |
|
| 1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|
| 2 |
PMID:11679672
"An extensive class of small RNAs in Caenorhabditis elegans"
Science. 294:862-864(2001).
|