Stem-loop sequence cbr-mir-74a

AccessionMI0000513 (change log)
Previous IDscbr-mir-74
DescriptionCaenorhabditis briggsae miR-74 stem-loop
Gene family MIPF0000275; mir-74
Stem-loop
   c    u        u    a    uc     -   ucuca 
5'  gcac uuugggcu ccau ucuu  ccagc ucc     u
    |||| |||||||| |||| ||||  ||||| |||     u
3'  cgug agaucuga ggua agaa  ggucg agg     u
   a    u        c    a    -c     u   uauca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4426602-4426682 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-74a
cbr-mir-2231chrX: 4430575-4430638 [-]
cbr-mir-73achrX: 4426887-4426980 [-]
cbr-mir-74bchrX: 4426711-4426827 [-]
cbr-mir-74achrX: 4426602-4426682 [-]
cbr-mir-785bchrX: 4421255-4421318 [+]
cbr-mir-75chrX: 4419739-4419830 [-]
Database links

Mature sequence cbr-miR-74a

Accession MIMAT0000483
Previous IDscbr-miR-74
Sequence

54 - 

uggcaagaaauggcagucuaga

 - 75

Get sequence
Evidence by similarity; MI0000045

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).