![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cbr-mir-75 |
||||||||||||
Accession | MI0000514 (change log) | |||||||||||
Description | Caenorhabditis briggsae miR-75 stem-loop | |||||||||||
Gene family | MIPF0000273; mir-75 | |||||||||||
Literature search |
1 open access papers mention cbr-mir-75 | |||||||||||
Stem-loop |
u ga - a c u ca c - -- a 5' gcga c cga uug ag cgguug agcuu aaua ca gac a |||| | ||| ||| || |||||| ||||| |||| || ||| 3' cgcu g gcu aac uc gccaac ucgaa uuau gu uug u g ac u a u c ca a a uc g |
|||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae. |
|||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence cbr-miR-75 |
|
Accession | MIMAT0000484 |
Sequence |
57 - uuaaagcuaccaaccgccuuca - 78 |
Evidence | by similarity; MI0000046 |
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|