Stem-loop sequence cbr-mir-75

AccessionMI0000514 (change log)
DescriptionCaenorhabditis briggsae miR-75 stem-loop
Gene family MIPF0000273; mir-75
Literature search

1 open access papers mention cbr-mir-75
(1 sentences)

Stem-loop 
   u    ga -   a   c  u      ca     c    -  --   a 
5'  gcga  c cga uug ag cgguug  agcuu aaua ca  gac a
    ||||  | ||| ||| || ||||||  ||||| |||| ||  |||  
3'  cgcu  g gcu aac uc gccaac  ucgaa uuau gu  uug u
   g    ac u   a   u  c      ca     a    a  uc   g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4419739-4419830 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-75
cbr-mir-73achrX: 4426887-4426980 [-]
cbr-mir-74bchrX: 4426711-4426827 [-]
cbr-mir-74achrX: 4426602-4426682 [-]
cbr-mir-785bchrX: 4421255-4421318 [+]
cbr-mir-75chrX: 4419739-4419830 [-]
Database links

Mature sequence cbr-miR-75

Accession MIMAT0000484
Sequence

57 -  

uuaaagcuaccaaccgccuuca

 - 78

Get sequence
Evidence by similarity; MI0000046

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).