Stem-loop sequence cbr-mir-81

AccessionMI0000519 (change log)
DescriptionCaenorhabditis briggsae miR-81 stem-loop
Gene family MIPF0000154; mir-81
Literature search

1 open access papers mention cbr-mir-81
(1 sentences)

Stem-loop
   c    -u      uc         cu      g   ---   auaa 
5'  guga  uaacgg  gguuuucac  ugaucu aga   gca    c
    ||||  ||||||  |||||||||  |||||| |||   |||     
3'  cacu  auuguu  ucgaaagug  acuaga ucu   cgu    c
   u    uc      ga         cu      g   auu   aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4359691-4359780 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-81
cbr-mir-81chrX: 4359691-4359780 [-]
cbr-mir-82chrX: 4356766-4356860 [+]
Database links

Mature sequence cbr-miR-81

Accession MIMAT0000488
Sequence

57 - 

ugagaucaucgugaaagcuagu

 - 78

Get sequence
Evidence by similarity; MI0000052

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).