Stem-loop sequence cbr-mir-82

AccessionMI0000520 (change log)
DescriptionCaenorhabditis briggsae miR-82 stem-loop
Gene family MIPF0000154; mir-81
Literature search

1 open access papers mention cbr-mir-82
(1 sentences)

Stem-loop
   a       -cu      a         c       g    ---g   ca 
5'  aguucuu   agcgac gguuuucgc gugaucu caga    uuc  u
    |||||||   |||||| ||||||||| ||||||| ||||    |||   
3'  ucaggag   ucguug ccgaaagug uacuaga gucu    aag  g
   c       aau      a         c       -    acaa   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4356766-4356860 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-82
cbr-mir-82chrX: 4356766-4356860 [+]
cbr-mir-81chrX: 4359691-4359780 [-]
Database links

Mature sequence cbr-miR-82

Accession MIMAT0000489
Sequence

59 - 

ugagaucaucgugaaagccagu

 - 80

Get sequence
Evidence by similarity; MI0000053

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).