Stem-loop sequence cbr-mir-86

AccessionMI0000522 (change log)
DescriptionCaenorhabditis briggsae miR-86 stem-loop
Gene family MIPF0000247; mir-86
Literature search

1 open access papers mention cbr-mir-86
(2 sentences)

Stem-loop
   c      ----      -           g  uu   a   u     auca 
5'  gaguca    augccg uuuaagugaau cu  gcc cag cuucg    u
    ||||||    |||||| ||||||||||| ||  ||| ||| |||||    g
3'  cucagu    ugcggc ggauucacuua ga  cgg guc gaagu    u
   a      uccu      c           -  uu   -   c     acac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 6376870-6376967 [-]
intergenic
Database links

Mature sequence cbr-miR-86

Accession MIMAT0000491
Sequence

16 - 

uaagugaaugcuuugccacaguc

 - 38

Get sequence
Evidence by similarity; MI0000057

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).