Stem-loop sequence cbr-mir-124

Accession

MI0000525

Description

Caenorhabditis briggsae miR-124 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

u      --uc    ua      c    uga   a       -   c  g 
 uuccag    guca  uggcgu cacc   gug cuuuagu gga au u
 ||||||    ||||  |||||| ||||   ||| ||||||| ||| || a
 aggguc    cggu  accgua gugg   cac ggaauca ccu ug u
u      uuaa    gc      a    -cg   -       a   u  a 

Deep sequencing

17 reads, 1 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context

• Coordinates (WS200): chrIV: 5050234-5050331 [-]
• Overlapping transcripts:

  intergenic

Mature sequence cbr-miR-124

• Accession: MIMAT0000494
• Sequence: 61 - uaaggcacgcggugaaugcca - 81
• Deep sequencing: 17 reads, 1 experiments
• Evidence: by similarity; MI0000302