Stem-loop sequence cbr-mir-124a

AccessionMI0000525 (change log)
Previous IDscbr-mir-124
DescriptionCaenorhabditis briggsae miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

2 open access papers mention cbr-mir-124a
(21 sentences)

Stem-loop
   u      --uc    ua      c    uga   a       -   c  g 
5'  uuccag    guca  uggcgu cacc   gug cuuuagu gga au u
    ||||||    ||||  |||||| ||||   ||| ||||||| ||| || a
3'  aggguc    cggu  accgua gugg   cac ggaauca ccu ug u
   u      uuaa    gc      a    -cg   -       a   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIV: 8910157-8910254 [+]
intergenic
Database links

Mature sequence cbr-miR-124a

Accession MIMAT0000494
Previous IDscbr-miR-124
Sequence

61 - 

uaaggcacgcggugaaugcca

 - 81

Get sequence
Evidence by similarity; MI0000302