Stem-loop sequence cbr-mir-233

AccessionMI0000530 (change log)
DescriptionCaenorhabditis briggsae miR-233 stem-loop
Gene family MIPF0000312; mir-233
Literature search

1 open access papers mention cbr-mir-233
(1 sentences)

Stem-loop
   a   -    -u              c - u      c    u  aaacc 
5'  agc auuu  ucugucccgcgcau c c uuguuc aaua uc     a
    ||| ||||  |||||||||||||| | | |||||| |||| ||     g
3'  ucg uaag  agacagggcgugua g g aacgag uuau ag     u
   g   a    uu              c c u      -    u  aaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 1737027-1737123 [+]
intergenic
Database links

Mature sequence cbr-miR-233

Accession MIMAT0000498
Sequence

60 - 

uugagcaaugcgcaugugcggga

 - 82

Get sequence
Evidence by similarity; MI0000308