Stem-loop sequence cbr-mir-248

AccessionMI0000536 (change log)
DescriptionCaenorhabditis briggsae miR-248 stem-loop
Gene family MIPF0000262; mir-248
Literature search

1 open access papers mention cbr-mir-248
(1 sentences)

Stem-loop
   u   -       -auu a    a    c     -uu -   u      aa  uu 
5'  gca aacugau    c cgau agcg uaucc   c cgu guauuc  gc  g
    ||| |||||||    | |||| |||| |||||   | ||| ||||||  ||   
3'  ugu uuggcua    g gcua ucgc auagg   g gca caugag  ug  g
   u   a       gucu a    c    a     cuc u   -      -c  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 4543318-4543421 [+]
intergenic
Database links

Mature sequence cbr-miR-248

Accession MIMAT0000504
Sequence

61 - 

uacacgugcucggauaacgcuca

 - 83

Get sequence
Evidence by similarity; MI0000324