Stem-loop sequence ath-MIR319a

Accession

MI0000544 (change log)

Description

Arabidopsis thaliana miR319a stem-loop

Gene family

MIPF0000010; MIR159

Literature search

45 open access papers mention ath-MIR319a
(302 sentences)

Stem-loop

       a          g      u   c   uc  g u           a -  u   ac        c  aa  c      gccaaaa 
5' agag gagcuuccuu agucca uca agg  gu a augauucaauu g cu ccg  ucauucau ca  ua cgaguc       u
   |||| |||||||||| |||||| ||| |||  || | ||||||||||| | || |||  |||||||| ||  || ||||||        
3' ucuc cucgagggaa ucaggu agu ucu  ua u uacuagguuaa c ga ggc  aguaagua gu  au gcucag       u
       c          g      u   u   cu  g -           a a  u   gu        a  aa  u      aucaaac 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

The A. thaliana jaw-D mutant has crinkly leaves and fruits, delayed flowering time and greenish petals. The jaw-D phenotype is caused by the over-expression of miR319 (also therefore known as miR-JAW), which is produced from a ~500 base long primary transcript RNA [1]. The mir-JAW microRNA is expressed in two forms, 20 and 21 nt, differing by the presence of the 3' terminal U. Cloned microRNA sequence was obtained from the jaw-D mutant. This miR has been shown targets TCP genes for cleavage [1]. This sequence is located on BAC F9D16. miR-JAW has a homologue located in BAC MBK23 (MI0000545). The mature excised miR shows sequence similarity to miR159 (MI0000189, MI0000218).

Genome context

• Coordinates (TAIR10; GCA_000001735.1): chr4: 12352956-12353131 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS00005DB89A_3702
• miRBase Tracker:MI0000544

Mature sequence ath-miR319a

• Accession: MIMAT0000511
• Sequence: 154 - uuggacugaagggagcucccu - 174
• Evidence: experimental; Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5]

References

1. PMID:12931144 "Control of leaf morphogenesis by microRNAs" Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D Nature. 425:257-263(2003).
2. PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3. PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4. PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5. PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).