miRBase entry: ath-MIR319a

Stem-loop ath-MIR319a


Accession
MI0000544
Description
Arabidopsis thaliana ath-MIR319a precursor miRNA
Gene family
MIPF0000010; MIR159

Literature search
45 open access papers mention ath-MIR319a
(315 sentences)

Sequence

agagagagcuuccuugaguccauucacaggucgugauaugauucaauuagcuuccgacucauucauccaaauaccgagucgccaaaauucaaacuagacucguuaaaugaaugaaugaugcgguagacaaauuggaucauugauucucuuugaUUGGACUGAAGGGAGCUCCCUcu
((((.((((((((((.((((((.(((.(((..((.(.(((((((((((.(((.(((..((((((((.((..((.((((((................)))))).))..)).))))))))..))).)).).)))))))))))).))..))).))).)))))).)))))))))).))))

Structure
    a          g      u   c   uc  g u           a -  u   ac        c  aa  c      gccaaaa 
agag gagcuuccuu agucca uca agg  gu a augauucaauu g cu ccg  ucauucau ca  ua cgaguc       u
|||| |||||||||| |||||| ||| |||  || | ||||||||||| | || |||  |||||||| ||  || ||||||        
ucUC CUCGAGGGAA UCAGGU agu ucu  ua u uacuagguuaa c ga ggc  aguaagua gu  au gcucag       u
    C          G      U   u   cu  g -           a a  u   gu        a  aa  u      aucaaac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The A. thaliana jaw-D mutant has crinkly leaves and fruits, delayed flowering time and greenish petals. The jaw-D phenotype is caused by the over-expression of miR319 (also therefore known as miR-JAW), which is produced from a ~500 base long primary transcript RNA [1]. The mir-JAW microRNA is expressed in two forms, 20 and 21 nt, differing by the presence of the 3' terminal U. Cloned microRNA sequence was obtained from the jaw-D mutant. This miR has been shown targets TCP genes for cleavage [1]. This sequence is located on BAC F9D16. miR-JAW has a homologue located in BAC MBK23 (MIR:MI0000545). The mature excised miR shows sequence similarity to miR159 (MIR:MI0000189, MIR:MI0000218).

Genome context
chr4: 12352956-12353131 [+]

Database links

Mature ath-miR319a

Accession MIMAT0000511
Description Arabidopsis thaliana ath-miR319a mature miRNA
Sequence 154 - UUGGACUGAAGGGAGCUCCCU - 174
Evidence experimental
Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 12931144
    Control of leaf morphogenesis by microRNAs
    "Palatnik JF, Allen E, Wu X, Schommer C, Schwab R, Carrington JC, Weigel D"
    "Nature (2003) 425:257-263