![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR319a |
|||||
Accession | MI0000544 (change log) | ||||
Description | Arabidopsis thaliana miR319a stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
45 open access papers mention ath-MIR319a | ||||
Stem-loop |
a g u c uc g u a - u ac c aa c gccaaaa 5' agag gagcuuccuu agucca uca agg gu a augauucaauu g cu ccg ucauucau ca ua cgaguc u |||| |||||||||| |||||| ||| ||| || | ||||||||||| | || ||| |||||||| || || |||||| 3' ucuc cucgagggaa ucaggu agu ucu ua u uacuagguuaa c ga ggc aguaagua gu au gcucag u c g u u cu g - a a u gu a aa u aucaaac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
The A. thaliana jaw-D mutant has crinkly leaves and fruits, delayed flowering time and greenish petals. The jaw-D phenotype is caused by the over-expression of miR319 (also therefore known as miR-JAW), which is produced from a ~500 base long primary transcript RNA [1]. The mir-JAW microRNA is expressed in two forms, 20 and 21 nt, differing by the presence of the 3' terminal U. Cloned microRNA sequence was obtained from the jaw-D mutant. This miR has been shown targets TCP genes for cleavage [1]. This sequence is located on BAC F9D16. miR-JAW has a homologue located in BAC MBK23 (MI0000545). The mature excised miR shows sequence similarity to miR159 (MI0000189, MI0000218). |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR319a |
|
Accession | MIMAT0000511 |
Sequence |
154 - uuggacugaagggagcucccu - 174 |
Evidence | experimental; Northern [1], 5'RACE [2], cloned [2], 454 [3], Illumina [5] |
References |
|
1 |
PMID:12931144
"Control of leaf morphogenesis by microRNAs"
Nature. 425:257-263(2003).
|
2 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
5 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|