Stem-loop sequence mmu-mir-148a

Accession

MI0000550 (change log)

Previous IDs

mmu-mir-148

Symbol

MGI:Mir148a

Description

Mus musculus miR-148a stem-loop

Gene family

MIPF0000056; mir-148

Literature search

96 open access papers mention mmu-mir-148a
(834 sentences)

Stem-loop

   a    guu        u              -  -a    cc    -   ag 
5'  gcca   uggucuuu gagacaaaguucug ag  cacu  gacu cug  u
    ||||   |||||||| |||||||||||||| ||  ||||  |||| |||  a
3'  uggu   gucggaga cucuguuucaagac uc  guga  cuga gau  u
   c    ---        u              a  ac    --    a   ag 

Deep sequencing

2307007 reads, 3.66e+03 reads per million, 107 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence was previsouly named mir-148 here and in [1], but is renamed to avoid confusion with mir-148b (MI0000617). This sequence maps to mouse chromosome 6.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr6: 51269812-51269910 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mir148a
• MGI:Mir148a
• RNAcentral:URS000075C560_10090
• miRBase Tracker:MI0000550

Mature sequence mmu-miR-148a-5p

• Accession: MIMAT0004617
• Previous IDs: mmu-miR-148a*
• Sequence: 23 - aaaguucugagacacuccgacu - 44
• Deep sequencing: 30451 reads, 88 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00003E16E5_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-148a-5p
  • miRDB:mmu-miR-148a-5p
  • microrna.org:mmu-miR-148a-5p

Mature sequence mmu-miR-148a-3p

• Accession: MIMAT0000516
• Previous IDs: mmu-miR-148a
• Sequence: 61 - ucagugcacuacagaacuuugu - 82
• Deep sequencing: 2276375 reads, 107 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00003BBF48_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-148a-3p
  • miRDB:mmu-miR-148a-3p
  • microrna.org:mmu-miR-148a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).