![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-148a |
|||||
Accession | MI0000550 (change log) | ||||
Previous IDs | mmu-mir-148 | ||||
Symbol | MGI:Mir148a | ||||
Description | Mus musculus miR-148a stem-loop | ||||
Gene family | MIPF0000056; mir-148 | ||||
Literature search |
![]()
96 open access papers mention mmu-mir-148a | ||||
Stem-loop |
a guu u - -a cc - ag 5' gcca uggucuuu gagacaaaguucug ag cacu gacu cug u |||| |||||||| |||||||||||||| || |||| |||| ||| a 3' uggu gucggaga cucuguuucaagac uc guga cuga gau u c --- u a ac -- a ag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was previsouly named mir-148 here and in [1], but is renamed to avoid confusion with mir-148b (MI0000617). This sequence maps to mouse chromosome 6. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-148a-5p |
|
Accession | MIMAT0004617 |
Previous IDs | mmu-miR-148a* |
Sequence |
23 - aaaguucugagacacuccgacu - 44 |
Deep sequencing | 30451 reads, 88 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-148a-3p |
|
Accession | MIMAT0000516 |
Previous IDs | mmu-miR-148a |
Sequence |
61 - ucagugcacuacagaacuuugu - 82 |
Deep sequencing | 2276375 reads, 107 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|