Stem-loop sequence mmu-mir-196a-1

AccessionMI0000552 (change log)
Previous IDsmmu-mir-196-1
Symbol MGI:Mir196a-1
DescriptionMus musculus miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Literature search

67 open access papers mention mmu-mir-196a-1
(583 sentences)

Stem-loop 
   u    c gg     uga     g     a    c         - gc ugg 
5'  gagc g  acugu   gugaa uaggu guuu auguuguug g  c   c
    |||| |  |||||   ||||| ||||| |||| ||||||||| |  |   u
3'  uucg c  ugacg   uacuu gucca caaa uacagcaac c  g   u
   c    u au     --g     a     c    c         a aa ucu
Get sequence
Deep sequencing
566981 reads, 1.94e+03 reads per million, 90 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 96265164-96265265 [+]
intergenic
Database links

Mature sequence mmu-miR-196a-5p

Accession MIMAT0000518
Previous IDsmmu-miR-196a
Sequence

24 -  

uagguaguuucauguuguuggg

 - 45

Get sequence
Deep sequencing1133875 reads, 90 experiments
Evidence experimental; cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-196a-1-3p

Accession MIMAT0017013
Previous IDsmmu-miR-196a-1*
Sequence

62 -  

caacgacaucaaaccaccugau

 - 83

Get sequence
Deep sequencing2859 reads, 39 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).