Stem-loop sequence mmu-let-7e

Accession MI0000561
Symbol MGI:Mirlet7e
Description Mus musculus let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    cc  c   cu   g                u  ggaaga ac 
 gcgc  cc ggg  gag uaggagguuguauagu ga      c  c
 ||||  || |||  ||| |||||||||||||||| ||      |   
 cgcg  gg ccc  uuc auccuccggcauauca cu      g  c
c    uc  a   cu   g                -  --agag ag 
Get sequence
Deep sequencing
33785894 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr17: 17830352-17830444 [+]
antisense
ENSMUST00000175058 ; AC165361.1-201; exon 1
Clustered miRNAs
< 10kb from mmu-let-7e
mmu-mir-99b chr17: 17830188-17830257 [+]
mmu-let-7e chr17: 17830352-17830444 [+]
mmu-mir-125a chr17: 17830812-17830879 [+]
Database links

Mature sequence mmu-let-7e-5p

Accession MIMAT0000524
Previous IDs mmu-let-7e
Sequence

15 - 

ugagguaggagguuguauaguu

 - 36

Get sequence
Deep sequencing 33349730 reads, 82 experiments
Evidence experimental; cloned [1-4], Solexa [5,7]
Validated targets
Predicted targets

Mature sequence mmu-let-7e-3p

Accession MIMAT0017016
Previous IDs mmu-let-7e*
Sequence

60 - 

cuauacggccuccuagcuuucc

 - 81

Get sequence
Deep sequencing 1938 reads, 56 experiments
Evidence experimental; 454 [6], Solexa [7]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).