![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-22 |
|||||
Accession | MI0000570 (change log) | ||||
Symbol | MGI:Mir22 | ||||
Description | Mus musculus miR-22 stem-loop | ||||
Gene family | MIPF0000053; mir-22 | ||||
Literature search |
![]()
120 open access papers mention mmu-mir-22 | ||||
Stem-loop |
a --u u cc - a u ccu 5' cc ggc gag gcaguaguucuucag uggca gcuuua gu g || ||| ||| ||||||||||||||| ||||| |||||| || a 3' gg ccg cuc cguugucaagaaguu accgu cgaaau cg c c ucc u -c g - - acc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-22-5p |
|
Accession | MIMAT0004629 |
Previous IDs | mmu-miR-22* |
Sequence |
19 - aguucuucaguggcaagcuuua - 40 |
Deep sequencing | 17097 reads, 106 experiments |
Evidence | experimental; cloned [5], Illumina [6-7] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-22-3p |
|
Accession | MIMAT0000531 |
Previous IDs | mmu-miR-22 |
Sequence |
57 - aagcugccaguugaagaacugu - 78 |
Deep sequencing | 2998275 reads, 108 experiments |
Evidence | experimental; cloned [1-2,4-5], Northern [2], Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
4 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|