miRBase entry: mmu-mir-23a

Stem-loop mmu-mir-23a


Accession
MI0000571
Symbol
MGI: Mir23a
Description
Mus musculus mmu-mir-23a precursor miRNA

Literature search
134 open access papers mention mmu-mir-23a
(877 sentences)

Sequence

646754 reads, 2731 reads per million, 107 experiments
cggacggcuGGGGUUCCUGGGGAUGGGAUUUgaugccagucacaaAUCACAUUGCCAGGGAUUUCCaacugaccc
.((.(((.((((((((((((.((((.((((((.((.....)))))))).)))).))))))).))))).))).)).

Structure
c  a   c     -       G    G      a  c 
 gg cgg uGGGG UUCCUGG GAUG GAUUUg ug c
 || ||| ||||| ||||||| |||| |||||| || a
 cc guc aCCUU AGGGACC UUAC CUAaac ac g
c  a   a     U       G    A      -  u 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr8: 84208518-84208592 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from mmu-mir-23a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-23a-5p

Accession MIMAT0017019
Description Mus musculus mmu-miR-23a-5p mature miRNA
Sequence 10 - GGGGUUCCUGGGGAUGGGAUUU - 31
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

Mature mmu-miR-23a-3p

Accession MIMAT0000532
Description Mus musculus mmu-miR-23a-3p mature miRNA
Sequence 46 - AUCACAUUGCCAGGGAUUUCC - 66
Evidence experimental
cloned [1-3], Illumina [4,6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275