Stem-loop sequence mmu-mir-26a-1

Accession MI0000573
Symbol MGI:Mir26a-1
Description Mus musculus miR-26a-1 stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a     -   g      u         c          g gca g 
 aggcc gug ccucgu caaguaauc aggauaggcu u   g u
 ||||| ||| |||||| ||||||||| |||||||||| |   |  
 uccgg cgc ggggca guucauugg ucuuauccgg g   c c
g     g   a      c         u          g -aa c 
Get sequence
Deep sequencing
2600444 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 119031796-119031885 [+]
sense
OTTMUST00000098000 ; Ctdspl-003; intron 4
OTTMUST00000098001 ; Ctdspl-004; intron 5
OTTMUST00000097998 ; Ctdspl-001; intron 5
ENSMUST00000172464 ; Ctdspl-003; intron 4
ENSMUST00000174841 ; Ctdspl-004; intron 5
ENSMUST00000073109 ; Ctdspl-001; intron 5
Database links

Mature sequence mmu-miR-26a-5p

Accession MIMAT0000533
Previous IDs mmu-miR-26a
Sequence

16 - 

uucaaguaauccaggauaggcu

 - 37

Get sequence
Deep sequencing 3733669 reads, 82 experiments
Evidence experimental; cloned [1-4], Solexa [5-6]
Validated targets
Predicted targets

Mature sequence mmu-miR-26a-1-3p

Accession MIMAT0017020
Previous IDs mmu-miR-26a-1*
Sequence

55 - 

ccuauucuugguuacuugcacg

 - 76

Get sequence
Deep sequencing 81 reads, 29 experiments
Evidence experimental; Solexa [6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).