Stem-loop sequence mmu-mir-93

Accession MI0000581
Symbol MGI:Mir93
Description Mus musculus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a   a         -ca       -     u    g   u  aau 
 guc ugggggcuc   aagugcu guucg gcag uag gu   u
 ||| |||||||||   ||||||| ||||| |||| ||| ||   a
 cag acccccgag   uucacga cgagu cguc auc ca   c
a   g         ccc       u     -    -   -  guc 
Get sequence
Deep sequencing
518448 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr5: 138165523-138165610 [-]
sense
OTTMUST00000054336 ; Mcm7-010; exon 1
OTTMUST00000054328 ; Mcm7-002; intron 8
OTTMUST00000054327 ; Mcm7-001; intron 13
ENSMUST00000125316 ; Mcm7-010; exon 1
ENSMUST00000148879 ; Mcm7-002; intron 8
ENSMUST00000000505 ; Mcm7-001; intron 13
Clustered miRNAs
< 10kb from mmu-mir-93
mmu-mir-106b chr5: 138165737-138165818 [-]
mmu-mir-93 chr5: 138165523-138165610 [-]
mmu-mir-25 chr5: 138165321-138165404 [-]
Database links

Mature sequence mmu-miR-93-5p

Accession MIMAT0000540
Previous IDs mmu-miR-93
Sequence

15 - 

caaagugcuguucgugcagguag

 - 37

Get sequence
Deep sequencing 263716 reads, 82 experiments
Evidence experimental; cloned [1-3], Northern [1], Solexa [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-93-3p

Accession MIMAT0004636
Previous IDs mmu-miR-93*
Sequence

54 - 

acugcugagcuagcacuucccg

 - 75

Get sequence
Deep sequencing 3245 reads, 81 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).