Stem-loop sequence mmu-mir-93

AccessionMI0000581
Symbol MGI:Mir93
DescriptionMus musculus miR-93 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20a/b, miR-93, and miR-106a/b. With the exception of miR-93, these microRNAs are produced from several microRNA gene clusters, which apparently arose from a series of ancient evolutionary genetic duplication events, and also include members of the miR-19, and miR-25 families. These clusters are transcribed as long non-coding RNA transcripts that are processed to form ~70 nucleotide microRNA precursors, that are subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. The mature microRNA products are thought to regulate expression levels of other genes through complementarity to the 3' UTR of specific target messenger RNA. The paralogous miRNA gene clusters that give rise to miR-17 family microRNAs (miR-17~92, miR-106a~363, and miR-106b~25) have been implicated in a wide variety of malignancies and are sometimes referred to as oncomirs. The oncogenic potential of these non-protein encoding genes was first identified in mouse viral tumorigenesis screens. In humans, the activating mutations of miR-17~92 have been identified in non-Hodgkin's lymphoma, whereas the miRNA constituents of the clusters are overexpressed in a multiple cancer types. High level expression of miR-17 family members induces cell proliferation, whereas deletion of the miR-17~92 cluster, in mice, is lethal and causes lung and lymphoid cell developmental defects.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a   a         -ca       -     u    g   u  aau 
5'  guc ugggggcuc   aagugcu guucg gcag uag gu   u
    ||| |||||||||   ||||||| ||||| |||| ||| ||   a
3'  cag acccccgag   uucacga cgagu cguc auc ca   c
   a   g         ccc       u     -    -   -  guc 
Get sequence
Deep sequencing
528620 reads, 2.47e+03 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr5: 138165523-138165610 [-]
sense
OTTMUST00000054336 ; Mcm7-010; exon 1
OTTMUST00000054328 ; Mcm7-002; intron 8
OTTMUST00000054327 ; Mcm7-001; intron 13
ENSMUST00000125316 ; Mcm7-010; exon 1
ENSMUST00000148879 ; Mcm7-002; intron 8
ENSMUST00000000505 ; Mcm7-001; intron 13
Clustered miRNAs
< 10kb from mmu-mir-93
mmu-mir-106bchr5: 138165737-138165818 [-]
mmu-mir-93chr5: 138165523-138165610 [-]
mmu-mir-25chr5: 138165321-138165404 [-]
Database links

Mature sequence mmu-miR-93-5p

Accession MIMAT0000540
Previous IDsmmu-miR-93
Sequence

15 - 

caaagugcuguucgugcagguag

 - 37

Get sequence
Deep sequencing243924 reads, 91 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4-5]
Validated targets
Predicted targets

Mature sequence mmu-miR-93-3p

Accession MIMAT0004636
Previous IDsmmu-miR-93*
Sequence

54 - 

acugcugagcuagcacuucccg

 - 75

Get sequence
Deep sequencing2989 reads, 84 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).