![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-34a |
|||||
Accession | MI0000584 (change log) | ||||
Previous IDs | mmu-mir-172;mmu-mir-34c | ||||
Symbol | MGI:Mir34a | ||||
Description | Mus musculus miR-34a stem-loop | ||||
Gene family | MIPF0000039; mir-34 | ||||
Literature search |
![]()
388 open access papers mention mmu-mir-34a | ||||
Stem-loop |
c c - a uu - a --gug a 5' cag ugug agua uucu ggcagugu cuu gcugguuguu agu u ||| |||| |||| |||| |||||||| ||| |||||||||| ||| 3' guu acac ucgu aaga ccgucaua gaa cgacuaacga ucg u u - g g uc u - aggaa a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Houbaviy et al. cloned this miRNA from embryonic stem cells and named it miR-172 [1]. This sequence is homologous to human miR-34a (MI0000268), and so is renamed miR-34a here. This sequence is not related to miR172 from plants (MI0000215 and MI0000216). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-34a-5p |
|
Accession | MIMAT0000542 |
Previous IDs | mmu-miR-34a |
Sequence |
20 - uggcagugucuuagcugguugu - 41 |
Deep sequencing | 55682 reads, 104 experiments |
Evidence | experimental; cloned [1,3], Illumina [4,6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-34a-3p |
|
Accession | MIMAT0017022 |
Previous IDs | mmu-miR-34a* |
Sequence |
64 - aaucagcaaguauacugcccu - 84 |
Deep sequencing | 1895 reads, 82 experiments |
Evidence | experimental; 454 [5], Illumina [6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|