|
miRBase |
|
Stem-loop sequence mmu-mir-103-1 |
|||||
| Accession | MI0000587 | ||||
| Symbol | MGI:Mir103-1 | ||||
| Description | Mus musculus miR-103-1 stem-loop | ||||
| Gene family | MIPF0000024; mir-103 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation. |
||||
| Stem-loop |
u c c -- u u c u g a ucuua ugcc uc ggcu cu uacagugcugc uug u c u ||||| |||| || |||| || ||||||||||| ||| | | agagu acgg ag ucgg ga auguuacgacg aac a g a c u a ua - c - u g u |
||||
| Deep sequencing |
| ||||
| Comments |
This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2-4]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence mmu-miR-103-1-5p |
|
| Accession | MIMAT0017024 |
| Previous IDs | mmu-miR-103-1* |
| Sequence |
15 - ggcuucuuuacagugcugccuug - 37 |
| Deep sequencing | 674 reads, 63 experiments |
| Evidence | experimental; 454 [6], Solexa [7] |
| Predicted targets |
|
Mature sequence mmu-miR-103-3p |
|
| Accession | MIMAT0000546 |
| Previous IDs | mmu-miR-103 |
| Sequence |
52 - agcagcauuguacagggcuauga - 74 |
| Deep sequencing | 11824393 reads, 82 experiments |
| Evidence | experimental; cloned [2-4], Solexa [5,7] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
| 2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
| 3 | |
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 7 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|