Stem-loop mmu-mir-322

Accession

MI0000590

Symbol

MGI: Mir322

Description

Mus musculus mmu-mir-322 precursor miRNA

Gene family

MIPF0000164; mir-322

Literature search

43 open access papers mention mmu-mir-322
(390 sentences)

Sequence

489744 reads, 4232 reads per million, 106 experiments

ccucguugacuccgaagggcugCAGCAGCAAUUCAUGUUUUGGAguauugccaagguucaAAACAUGAAGCGCUGCAACACcccuucguggggaa
.........((((((((((.((..(((((..(((((((((((((.(........).)))))))))))))..)))))..)).))))))).)))...

Structure

ccucguuga   -       c  CA     AA             g auu 
         cuc cgaaggg ug  GCAGC  UUCAUGUUUUGGA u   g
         ||| ||||||| ||  |||||  ||||||||||||| |    
         ggg gcuuccc AC  CGUCG  AAGUACAAAacuu g   c
------aag   u       C  AA     CG             g aac 

Annotation confidence High

Comments

The mir-322 locus appears able to express two mature miRNA sequences. Poy et al. cloned a sequence originating from the 5' arm from mouse pancreatic beta cells [2]. This sequence is orthologous to the experimentally validated miR-424 sequence from human (MIR:MI0001446), but was named miR-322-5p in [2]. The mature product from the 3' arm of this precursor sequence is the predicted mouse homologue of miR-322, experimentally verified in rat (MIR:MI0000589) [1], and later in mouse [3]. The orthologous human locus does not appear to contain the miR-322 sequence. Landgraf et al. confirm that the 5' product is the predominant one [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chrX: 53054255-53054349 [-]

Clustered miRNAs

6 other miRNAs are < 10 kb from mmu-mir-322

Mature mmu-miR-322-5p

• Accession: MIMAT0000548
• Description: Mus musculus mmu-miR-322-5p mature miRNA
• Sequence: 23 - CAGCAGCAAUUCAUGUUUUGGA - 44
• Evidence: experimental ; cloned [2,4], Illumina [5-6]

Mature mmu-miR-322-3p

• Accession: MIMAT0000549
• Description: Mus musculus mmu-miR-322-3p mature miRNA
• Sequence: 61 - AAACAUGAAGCGCUGCAACAC - 81
• Evidence: experimental ; cloned [3-4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


3. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365