Stem-loop sequence mmu-mir-323

Accession MI0000592
Symbol MGI:Mir323
Description Mus musculus miR-323 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop 
---uu      u g        g u     gcgc  u    uca 
     gguacu g agagaggu g ccgug    gu cgcu   u
     |||||| | |||||||| | |||||    || ||||    
     cuaugg c uuucucca c ggcac    ca gcgg   u
cuaau      - g        g u     auua  c    uau
Get sequence
Deep sequencing
17602 reads, 65 experiments
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MI0000591 ). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109712508-109712593 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-323
mmu-mir-379 chr12: 109709060-109709125 [+]
mmu-mir-411 chr12: 109710175-109710256 [+]
mmu-mir-299a chr12: 109710638-109710700 [+]
mmu-mir-299b chr12: 109710645-109710693 [-]
mmu-mir-380 chr12: 109711803-109711863 [+]
mmu-mir-1197 chr12: 109712317-109712436 [+]
mmu-mir-323 chr12: 109712508-109712593 [+]
mmu-mir-758 chr12: 109712810-109712890 [+]
mmu-mir-329 chr12: 109713481-109713577 [+]
mmu-mir-494 chr12: 109715318-109715402 [+]
mmu-mir-679 chr12: 109715577-109715650 [+]
mmu-mir-1193 chr12: 109715671-109715791 [+]
mmu-mir-666 chr12: 109717085-109717183 [+]
mmu-mir-543 chr12: 109717258-109717333 [+]
mmu-mir-495 chr12: 109718754-109718816 [+]
mmu-mir-667 chr12: 109720006-109720097 [+]
Database links

Mature sequence mmu-miR-323-5p

Accession MIMAT0004638
Sequence

16 -  

aggugguccguggcgcguucgc

 - 37

Get sequence
Deep sequencing 879 reads, 29 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-323-3p

Accession MIMAT0000551
Previous IDs mmu-miR-323
Sequence

51 -  

cacauuacacggucgaccucu

 - 71

Get sequence
Deep sequencing 16715 reads, 62 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).