![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-325 |
|||||
Accession | MI0000597 (change log) | ||||
Symbol | MGI:Mir325 | ||||
Description | Mus musculus miR-325 stem-loop | ||||
Gene family | MIPF0000147; mir-325 | ||||
Literature search |
![]()
6 open access papers mention mmu-mir-325 | ||||
Stem-loop |
----------a cc u uu gug 5' uauagugcuugguu uag aggugcucaguaagug u a |||||||||||||| ||| |||||||||||||||| | 3' gugucacgaacuaa auc uccacgaguuauuugc a c ggucucggauc cu c uu aua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-325-5p |
|
Accession | MIMAT0000558 |
Previous IDs | mmu-miR-325;mmu-miR-325* |
Sequence |
16 - ccuaguaggugcucaguaagugu - 38 |
Deep sequencing | 665 reads, 22 experiments |
Evidence | experimental; Illumina [3-4] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-325-3p |
|
Accession | MIMAT0004640 |
Previous IDs | mmu-miR-325 |
Sequence |
54 - uuuauugagcaccuccuaucaa - 75 |
Deep sequencing | 1062 reads, 28 experiments |
Evidence | experimental; cloned [2], Illumina [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|