Stem-loop sequence rno-mir-328a

Accession

MI0000602 (change log)

Previous IDs

rno-mir-328

Description

Rattus norvegicus miR-328a stem-loop

Gene family

MIPF0000203; mir-328

Literature search

18 open access papers mention rno-mir-328a
(255 sentences)

Stem-loop

   ---     -      -------     ga     u     agaaa  au 
5'    ugggg cagggg       ggcag  ggggc caggg     gc  c
      ||||| ||||||       |||||  ||||| |||||     ||  u
3'    acccc gucccc       ccguc  ucccg guccc     cg  a
   uaa     u      ugccuuc     uc     -     -----  ac 

Deep sequencing

339588 reads, 186 reads per million, 500 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr19: 37263199-37263282 [-]
• Overlapping transcripts:

  antisense

  ENSRNOT00000021362 ; Elmo3-201; intron 13

Clustered miRNAs

< 10kb from rno-mir-328a

• rno-mir-328a: chr19: 37263199-37263282 [-]
• rno-mir-6318: chr19: 37262625-37262733 [-]

Database links

• EntrezGene:Mir328
• miRBase Tracker:MI0000602

Mature sequence rno-miR-328a-5p

• Accession: MIMAT0017029
• Previous IDs: rno-miR-328a*
• Sequence: 8 - ggggggcaggaggggcuca - 26
• Deep sequencing: 142 reads, 92 experiments
• Evidence: experimental; SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-328a-5p
  • miRDB:rno-miR-328a-5p

Mature sequence rno-miR-328a-3p

• Accession: MIMAT0000564
• Previous IDs: rno-miR-328;rno-miR-328a
• Sequence: 48 - cuggcccucucugcccuuccgu - 69
• Deep sequencing: 339403 reads, 500 experiments
• Evidence: experimental; cloned [1-2], Northern [1], SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-328a-3p
  • miRDB:rno-miR-328a-3p
  • microrna.org:rno-miR-328a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).