|
miRBase |
|
Stem-loop sequence rno-mir-328a |
||||||
| Accession | MI0000602 | |||||
| Previous IDs | rno-mir-328 | |||||
| Description | Rattus norvegicus miR-328a stem-loop | |||||
| Gene family | MIPF0000203; mir-328 | |||||
| Stem-loop |
--- - ------- ga u agaaa au ugggg cagggg ggcag ggggc caggg gc c ||||| |||||| ||||| ||||| ||||| || u acccc gucccc ccguc ucccg guccc cg a uaa u ugccuuc uc - ----- ac |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
Mature sequence rno-miR-328a-5p |
|
| Accession | MIMAT0017029 |
| Previous IDs | rno-miR-328a* |
| Sequence |
8 - ggggggcaggaggggcuca - 26 |
| Evidence | experimental; SOLiD [3] |
| Predicted targets |
|
Mature sequence rno-miR-328a-3p |
|
| Accession | MIMAT0000564 |
| Previous IDs | rno-miR-328;rno-miR-328a |
| Sequence |
48 - cuggcccucucugcccuuccgu - 69 |
| Evidence | experimental; cloned [1-2], Northern [1], SOLiD [3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|