![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-328a |
||||||
Accession | MI0000602 (change log) | |||||
Previous IDs | rno-mir-328 | |||||
Description | Rattus norvegicus miR-328a stem-loop | |||||
Gene family | MIPF0000203; mir-328 | |||||
Literature search |
![]()
18 open access papers mention rno-mir-328a | |||||
Stem-loop |
--- - ------- ga u agaaa au 5' ugggg cagggg ggcag ggggc caggg gc c ||||| |||||| ||||| ||||| ||||| || u 3' acccc gucccc ccguc ucccg guccc cg a uaa u ugccuuc uc - ----- ac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-328a-5p |
|
Accession | MIMAT0017029 |
Previous IDs | rno-miR-328a* |
Sequence |
8 - ggggggcaggaggggcuca - 26 |
Deep sequencing | 142 reads, 92 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-328a-3p |
|
Accession | MIMAT0000564 |
Previous IDs | rno-miR-328;rno-miR-328a |
Sequence |
48 - cuggcccucucugcccuuccgu - 69 |
Deep sequencing | 339403 reads, 500 experiments |
Evidence | experimental; cloned [1-2], Northern [1], SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|