Stem-loop mmu-mir-329

Accession

MI0000605

Symbol

MGI: Mir329

Description

Mus musculus mmu-mir-329 precursor miRNA

Gene family

MIPF0000110; mir-329

Literature search

19 open access papers mention mmu-mir-329
(100 sentences)

Sequence

14341 reads, 312 reads per million, 73 experiments

uguucgcuucugguaccggaagAGAGGUUUUCUGGGUCUCUGUUucuuugaugagaaugaAACACACCCAGCUAACCUUUUUuucaguaucaaaucc
..........((((((.((((((((((((..((((((...((((((.((......)).)))))).))))))..)))))))))))).)))))).....

Structure

uguucgcuuc      c            UU      CUC      u  ga 
          ugguac ggaagAGAGGUU  CUGGGU   UGUUuc uu  u
          |||||| ||||||||||||  ||||||   |||||| ||   
          acuaug cuuUUUUUCCAA  GACCCA   ACAAag aa  g
-----ccuaa      a            UC      --C      u  ga 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000604). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. verified expression by cloining [3].

Genome context

chr12: 109713481-109713577 [+]

Clustered miRNAs

18 other miRNAs are < 10 kb from mmu-mir-329

Mature mmu-miR-329-5p

• Accession: MIMAT0017032
• Description: Mus musculus mmu-miR-329-5p mature miRNA
• Sequence: 23 - AGAGGUUUUCUGGGUCUCUGUU - 44
• Evidence: experimental ; 454 [5], Illumina [6]

Mature mmu-miR-329-3p

• Accession: MIMAT0000567
• Description: Mus musculus mmu-miR-329-3p mature miRNA
• Sequence: 61 - AACACACCCAGCUAACCUUUUU - 82
• Evidence: experimental ; cloned [3], Illumina [4,6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


5. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748


6. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365