![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-140 |
|||||
Accession | MI0000611 (change log) | ||||
Description | Rattus norvegicus miR-140 stem-loop | ||||
Gene family | MIPF0000085; mir-140 | ||||
Literature search |
![]()
35 open access papers mention rno-mir-140 | ||||
Stem-loop |
- u cucu - a a uu uc 5' gug cucu guguccug cc gugguuuuacccu ugguagg aca a ||| |||| |||||||| || ||||||||||||| ||||||| ||| 3' cac gagg cauaggac gg caccaagauggga accaucu ugu u c - ---u a - c -- cg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The cloned miRNA appears to be expressed from the 3' strand of the precursor, and is therefore named miR-140* here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-140-5p |
|
Accession | MIMAT0000573 |
Previous IDs | rno-miR-140 |
Sequence |
22 - cagugguuuuacccuaugguag - 43 |
Deep sequencing | 30410 reads, 489 experiments |
Evidence | experimental; cloned [3-4], SOLiD [5] |
Predicted targets |
|
Mature sequence rno-miR-140-3p |
|
Accession | MIMAT0000574 |
Previous IDs | rno-miR-140* |
Sequence |
61 - uaccacaggguagaaccacgg - 81 |
Deep sequencing | 979040 reads, 507 experiments |
Evidence | experimental; cloned [1-2,4], Northern [1], SOLiD [5] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|