Stem-loop rno-mir-140

Accession

MI0000611

Description

Rattus norvegicus rno-mir-140 precursor miRNA

Literature search

35 open access papers mention rno-mir-140
(175 sentences)

Sequence

612529 reads, 1790 reads per million, 501 experiments

gugucucucucuguguccugcCAGUGGUUUUACCCUAUGGUAGguuacaucaugcuguucUACCACAGGGUAGAACCACGGacaggauacuggagcacc
(((.((((....((((((((((.(((((((((((((.(((((((..(((......)))))))))).))))))))))))))).)))))))).))))))).

Structure

-   u    cucu        -  A             A       uu   uc 
 gug cucu    guguccug cC GUGGUUUUACCCU UGGUAGg  aca  a
 ||| ||||    |||||||| || ||||||||||||| |||||||  |||   
 cac gagg    cauaggac GG CACCAAGAUGGGA ACCAUcu  ugu  u
c   -    ---u        a  -             C       --   cg 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The cloned miRNA appears to be expressed from the 3' strand of the precursor, and is therefore named miR-140* here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr19: 39608951-39609049 [+]

Mature rno-miR-140-5p

• Accession: MIMAT0000573
• Description: Rattus norvegicus rno-miR-140-5p mature miRNA
• Sequence: 22 - CAGUGGUUUUACCCUAUGGUAG - 43
• Evidence: experimental ; cloned [3-4], SOLiD [5]

Mature rno-miR-140-3p

• Accession: MIMAT0000574
• Description: Rattus norvegicus rno-miR-140-3p mature miRNA
• Sequence: 61 - UACCACAGGGUAGAACCACGG - 81
• Evidence: experimental ; cloned [1-2,4], Northern [1], SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68