miRBase entry: rno-mir-342

Stem-loop rno-mir-342


Accession
MI0000626
Description
Rattus norvegicus rno-mir-342 precursor miRNA

Literature search
15 open access papers mention rno-mir-342
(33 sentences)

Sequence

75343 reads, 59 reads per million, 491 experiments
gaaaaugggcucaaggugAGGGGUGCUAUCUGUGAUUGAGggacauggucaauggaauugUCUCACACAGAAAUCGCACCCGUcaccuuggccugcuga
......((((.((((((((.((((((..((((((..(((((.((((.....)))....).)))))))))))....)))))).)))))))))))).....

Structure
gaaaau    u        G      --UA      AU     g ----   g 
      gggc caaggugA GGGUGC    UCUGUG  UGAGg a    cau g
      |||| |||||||| ||||||    ||||||  ||||| |    ||| u
      uccg guuccacU CCCACG    AGACAC  ACUCU u    gua c
-agucg    -        G      CUAA      --     g uaag   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr6: 132561169-132561267 [+]

Database links

Mature rno-miR-342-5p

Accession MIMAT0004652
Description Rattus norvegicus rno-miR-342-5p mature miRNA
Sequence 19 - AGGGGUGCUAUCUGUGAUUGAG - 40
Evidence experimental
cloned [4], SOLiD [5]

Mature rno-miR-342-3p

Accession MIMAT0000589
Description Rattus norvegicus rno-miR-342-3p mature miRNA
Sequence 61 - UCUCACACAGAAAUCGCACCCGU - 83
Evidence experimental
cloned [1-4], Northern [1], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68