Stem-loop rno-mir-343

Accession

MI0000628

Description

Rattus norvegicus rno-mir-343 precursor miRNA

Gene family

MIPF0000411; mir-343

Literature search

4 open access papers mention rno-mir-343
(4 sentences)

Sequence

gcaccuucauggaccuggaguagaguggguguggcggggggagcagggcccagggcaaccUCUCCCUCCGUGUGCCCAGAuccugcaugccaa
...((.....))...(((.((((..((((((..((((((((((.((((((...)))..))))))))))))).))))))....))))...))).

Structure

gcaccuucauggacc   --a    --ag      ug          c   --   c 
               ugg   guag    ugggug  gcggggggag agg  gcc  
               |||   ||||    ||||||  |||||||||| |||  ||| a
               acc   cguc    ACCCGU  UGCCUCCCUC Ucc  cgg  
--------------a   gua    cuAG      -G          -   aa   g 

Annotation confidence Not enough data

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal UU sequence, which conflicts with the precursor sequence shown here.

Genome context

chr1: 80298686-80298778 [+]

Mature rno-miR-343

• Accession: MIMAT0000591
• Description: Rattus norvegicus rno-miR-343 mature miRNA
• Sequence: 61 - UCUCCCUCCGUGUGCCCAGA - 80
• Evidence: experimental ; cloned [1], SOLiD [2]

References

1. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


2. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249