Stem-loop mmu-mir-344-1

Accession

MI0000630

Symbol

MGI: Mir344

Description

Mus musculus mmu-mir-344-1 precursor miRNA

Gene family

MIPF0000267; mir-344

Literature search

10 open access papers mention mmu-mir-344-1
(33 sentences)

Sequence

16494 reads, 215 reads per million, 50 experiments

cugcagccaggguuuuuaccAGUCAGGCUCCUGGCUAGAUUCCAGGuaccagcugguaccUGAUCUAGCCAAAGCCUGACUGUaagcccugaaca
.......((((((((....((((((((((..(((((((((..((((((((....))))))))))))))))).)))))))))).))))))))....

Structure

cugcagc        uuac          CC         UC        a 
       caggguuu    cAGUCAGGCU  UGGCUAGAU  CAGGuacc g
       ||||||||    ||||||||||  |||||||||  ||||||||  
       gucccgaa    GUCAGUCCGA  ACCGAUCUA  GUccaugg c
---acaa        ---U          -A         --        u 

Annotation confidence Not enough data

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000629) - its expression was later independently verified in mouse [2].

Genome context

chr7: 61877770-61877864 [-]

Mature mmu-miR-344-5p

• Accession: MIMAT0017038
• Description: Mus musculus mmu-miR-344-5p mature miRNA
• Sequence: 21 - AGUCAGGCUCCUGGCUAGAUUCCAGG - 46
• Evidence: experimental ; Illumina [3]

Mature mmu-miR-344-3p

• Accession: MIMAT0000593
• Description: Mus musculus mmu-miR-344-3p mature miRNA
• Sequence: 61 - UGAUCUAGCCAAAGCCUGACUGU - 83
• Evidence: experimental ; cloned [1], Illumina [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365