Stem-loop sequence rno-mir-345

Accession MI0000631
Description Rattus norvegicus miR-345 stem-loop
Gene family MIPF0000189; mir-345
Stem-loop 
--------acc   gu     c  g u          c   u    -      
           caa  ccagg cu c gaccccuagu cag gcuu guggu 
           |||  ||||| || | |||||||||| ||| |||| |||| g
           guu  ggucc ga g cuggggauca guc cggg caucg 
ggacaccucua   ug     a  g u          a   c    u
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
6: 133178806-133178901 [+]
intergenic
Database links
  • ENTREZGENE: 100314147;Mir345

Mature sequence rno-miR-345-5p

Accession MIMAT0000594
Previous IDs rno-miR-345
Sequence

16 -  

ugcugaccccuaguccagugc

 - 36

Get sequence
Evidence experimental; cloned [1-3], Northern [1], SOLiD [5]
Predicted targets

Mature sequence rno-miR-345-3p

Accession MIMAT0004655
Sequence

54 -  

cccugaacuaggggucuggaga

 - 75

Get sequence
Evidence experimental; cloned [4], SOLiD [5]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
3
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).