Stem-loop sequence mmu-mir-345

Accession

MI0000632 (change log)

Symbol

MGI:Mir345

Description

Mus musculus miR-345 stem-loop

Gene family

MIPF0000189; mir-345

Literature search

13 open access papers mention mmu-mir-345
(25 sentences)

Stem-loop

   --------acc   gu     c  g u          c   u    -      
5'            caa  ccagg cu c gaccccuagu cag gcuu guggu 
              |||  ||||| || | |||||||||| ||| |||| |||| g
3'            guu  ggucc ga g cuggggauca guc cggg caucg 
   ggacaccucua   ug     a  g u          a   c    u      

Deep sequencing

138060 reads, 495 reads per million, 106 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA was predicted based on homology to the verified rat sequence (MI0000631). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later verified mature miRNA expression from both arms of the hairpin precursor [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr12: 108836973-108837068 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:Mirn345
• MGI:Mir345
• RNAcentral:URS00006D54B9_10090
• miRBase Tracker:MI0000632

Mature sequence mmu-miR-345-5p

• Accession: MIMAT0000595
• Previous IDs: mmu-miR-345
• Sequence: 17 - gcugaccccuaguccagugcuu - 38
• Deep sequencing: 59205 reads, 104 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00004C7BC0_10090
• Predicted targets:
  • miRDB:mmu-miR-345-5p
  • microrna.org:mmu-miR-345-5p

Mature sequence mmu-miR-345-3p

• Accession: MIMAT0004656
• Sequence: 55 - ccugaacuaggggucuggagac - 76
• Deep sequencing: 78779 reads, 102 experiments
• Evidence: experimental; cloned [3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00002F98D4_10090
• Predicted targets:
  • miRDB:mmu-miR-345-3p
  • microrna.org:mmu-miR-345-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).