![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-345 |
|||||
Accession | MI0000632 (change log) | ||||
Symbol | MGI:Mir345 | ||||
Description | Mus musculus miR-345 stem-loop | ||||
Gene family | MIPF0000189; mir-345 | ||||
Literature search |
![]()
13 open access papers mention mmu-mir-345 | ||||
Stem-loop |
--------acc gu c g u c u - 5' caa ccagg cu c gaccccuagu cag gcuu guggu ||| ||||| || | |||||||||| ||| |||| |||| g 3' guu ggucc ga g cuggggauca guc cggg caucg ggacaccucua ug a g u a c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA was predicted based on homology to the verified rat sequence (MI0000631). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later verified mature miRNA expression from both arms of the hairpin precursor [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-345-5p |
|
Accession | MIMAT0000595 |
Previous IDs | mmu-miR-345 |
Sequence |
17 - gcugaccccuaguccagugcuu - 38 |
Deep sequencing | 59205 reads, 104 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-345-3p |
|
Accession | MIMAT0004656 |
Sequence |
55 - ccugaacuaggggucuggagac - 76 |
Deep sequencing | 78779 reads, 102 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 |
PMID:15310658
"A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain"
Genome Res. 14:1741-1748(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|