Stem-loop sequence rno-mir-349

AccessionMI0000636 (change log)
DescriptionRattus norvegicus miR-349 stem-loop
Literature search

1 open access papers mention rno-mir-349
(5 sentences)

Stem-loop
   -----------------gaagacucuagcauguaagguu             -  g 
5'                                        gggggagggggcu gu u
                                          ||||||||||||| || c
3'                                        ccccuucuucuga cg u
   ccucggccuuguggaucuccaauucugucgucccgacac             a  a 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1].

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr7: 130146518-130146614 [-]
sense
ENSRNOT00000010467 ; Plxnb2-201; exon 5
Database links

Mature sequence rno-miR-349

Accession MIMAT0000599
Sequence

61 - 

cagcccugcugucuuaaccucu

 - 82

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; cloned [1], Northern [1]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).