Stem-loop mmu-mir-350

Accession

MI0000640

Symbol

MGI: Mir350

Description

Mus musculus mmu-mir-350 precursor miRNA

Gene family

MIPF0000245; mir-350

Literature search

9 open access papers mention mmu-mir-350
(37 sentences)

Sequence

33166 reads, 352 reads per million, 105 experiments

agaugccuugcuccuacaagaguAAAGUGCAUGCGCUUUGGGacagugaggaaaauaaugUUCACAAAGCCCAUACACUUUCacccuuuaggagaguug
..........((((((.(((.((((((((.(((.(((((((((((.............))))).)))))).))).)))))).)).))))))))).....

Structure

agaugccuug      c   a  -      C   C      -     gugag 
          cuccua aag gu AAAGUG AUG GCUUUG GGaca     g
          |||||| ||| || |||||| ||| |||||| |||||     a
          gaggau uuc ca UUUCAC UAC CGAAAC CUUgu     a
-----guuga      -   c  C      A   C      A     aauaa 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000639) - its expression was later independently verified in mouse [2]. The sequence reported in [1] contains a 5' terminal A residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr1: 176772325-176772423 [-]

Mature mmu-miR-350-5p

• Accession: MIMAT0017040
• Description: Mus musculus mmu-miR-350-5p mature miRNA
• Sequence: 24 - AAAGUGCAUGCGCUUUGGG - 42
• Evidence: experimental ; 454 [5], Illumina [6]

Mature mmu-miR-350-3p

• Accession: MIMAT0000605
• Description: Mus musculus mmu-miR-350-3p mature miRNA
• Sequence: 61 - UUCACAAAGCCCAUACACUUUC - 82
• Evidence: experimental ; cloned [2-3], Illumina [4,6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


6. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365