miRBase entry: rno-mir-351-1

Stem-loop rno-mir-351-1


Accession
MI0000642
Description
Rattus norvegicus rno-mir-351-1 precursor miRNA
Gene family
MIPF0000244; mir-351

Literature search
12 open access papers mention rno-mir-351-1
(26 sentences)

Sequence

1415024 reads, 1104 reads per million, 498 experiments
cauggcaccuccauuUCCCUGAGGAGCCCUUUGAGCCUGAggugaaaaaaaaacaGGUCAAGAGGCGCCUGGGAACuggag
........(((((.(((((..(((.(((.(((((.((((..............))))))))).))).)))))))).)))))

Structure
cauggcac     u     UG   A   C     G    Agguga 
        cucca uUCCC  AGG GCC UUUGA CCUG      a
        ||||| |||||  ||| ||| ||||| ||||       
        gaggu AAGGG  UCC CGG GAACU GGac      a
--------     C     --   G   A     -    aaaaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal U residue, which conflicts with the precursor sequence shown here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chrX: 158149206-158149286 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from rno-mir-351-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-351-5p

Accession MIMAT0000608
Description Rattus norvegicus rno-miR-351-5p mature miRNA
Sequence 16 - UCCCUGAGGAGCCCUUUGAGCCUGA - 40
Evidence experimental
cloned [1-3], Northern [1], SOLiD [4]

Mature rno-miR-351-3p

Accession MIMAT0017041
Description Rattus norvegicus rno-miR-351-3p mature miRNA
Sequence 56 - GGUCAAGAGGCGCCUGGGAAC - 76
Evidence experimental
SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249