Stem-loop sequence mmu-mir-135b

Accession MI0000646
Symbol MGI:Mir135b
Description Mus musculus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
------c     --                   cau          uug ug 
       gcucu  gcuguggccuauggcuuuu   uccuauguga   c  c
       |||||  |||||||||||||||||||   ||||||||||   |   
       cgggg  ugacaucggguaccgaaaa   gggauguacu   g  u
ccucgaa     ag                   -uc          caa cc 
Get sequence
Deep sequencing
194312 reads, 70 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 132198088-132198184 [+]
sense
ENSMUST00000112357 ; Lemd1-201; intron 1
Database links

Mature sequence mmu-miR-135b-5p

Accession MIMAT0000612
Previous IDs mmu-miR-135b
Sequence

16 - 

uauggcuuuucauuccuauguga

 - 38

Get sequence
Deep sequencing 191747 reads, 55 experiments
Evidence experimental; cloned [1], Solexa [2-3]
Predicted targets

Mature sequence mmu-miR-135b-3p

Accession MIMAT0017044
Previous IDs mmu-miR-135b*
Sequence

55 - 

auguagggcuaaaagccauggg

 - 76

Get sequence
Deep sequencing 503 reads, 30 experiments
Evidence experimental; Solexa [3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).