Stem-loop rno-mir-151

Accession

MI0000647

Description

Rattus norvegicus rno-mir-151 precursor miRNA

Literature search

11 open access papers mention rno-mir-151
(99 sentences)

Sequence

2242366 reads, 1896 reads per million, 506 experiments

agcgcuuuccugcccUCGAGGAGCUCACAGUCUAGUaugucuccucccuaCUAGACUGAGGCUCCUUGAGGacagggaucgucauacucaccucccg
.(((..((((((.((((((((((((..((((((((((.(........))))))))))).)))))))))))).)))))).)))...............

Structure

--------------a   cu      c            CA          u ucu 
               gcg  uuccug ccUCGAGGAGCU  CAGUCUAGUa g   c
               |||  |||||| ||||||||||||  |||||||||| |    
               ugc  agggac GGAGUUCCUCGG  GUCAGAUCau c   c
gcccuccacucauac   -u      a            -A          - ccu 

Annotation confidence High

Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. Landgraf et al show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr7: 114485547-114485643 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from rno-mir-151

Mature rno-miR-151-5p

• Accession: MIMAT0000613
• Description: Rattus norvegicus rno-miR-151-5p mature miRNA
• Sequence: 16 - UCGAGGAGCUCACAGUCUAGU - 36
• Evidence: experimental ; cloned [1-3], SOLiD [4]

Mature rno-miR-151-3p

• Accession: MIMAT0000614
• Description: Rattus norvegicus rno-miR-151-3p mature miRNA
• Sequence: 51 - CUAGACUGAGGCUCCUUGAGG - 71
• Evidence: experimental ; cloned [3], SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249